ID: 1019983977_1019983982

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1019983977 1019983982
Species Human (GRCh38) Human (GRCh38)
Location 7:4641919-4641941 7:4641941-4641963
Sequence CCGGGAGCTCTGTTTATAAACAC CACGGCGCGGCTGCCGGCGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!