ID: 1020192309_1020192318

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1020192309 1020192318
Species Human (GRCh38) Human (GRCh38)
Location 7:6009515-6009537 7:6009535-6009557
Sequence CCCCGCCCAGTGCGCACGCGCGG CGGCGACCGGCTGCTGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 5, 3: 15, 4: 86} {0: 1, 1: 0, 2: 4, 3: 18, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!