ID: 1020214252_1020214262

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1020214252 1020214262
Species Human (GRCh38) Human (GRCh38)
Location 7:6177608-6177630 7:6177645-6177667
Sequence CCATAATACGGTAATGCCTCTCT GGGAGAGGAACCGGTTGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64} {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!