ID: 1020409724_1020409727

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1020409724 1020409727
Species Human (GRCh38) Human (GRCh38)
Location 7:7877742-7877764 7:7877760-7877782
Sequence CCATATAATAAATATACAAATTA AATTAGGCTATGAAGGTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 178, 4: 2000} {0: 1, 1: 0, 2: 3, 3: 12, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!