|
Left Crispr |
Right Crispr |
Crispr ID |
1020710345 |
1020710350 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:11597596-11597618
|
7:11597635-11597657
|
Sequence |
CCCTGCCATCTTCTGCAGATAAC |
GACAGCTCTTGGCCTGTTACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 180, 1: 172, 2: 120, 3: 86, 4: 284} |
{0: 162, 1: 189, 2: 129, 3: 114, 4: 178} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|