ID: 1021279781_1021279789

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1021279781 1021279789
Species Human (GRCh38) Human (GRCh38)
Location 7:18703733-18703755 7:18703758-18703780
Sequence CCCTCTCCTTCCAGAAATAACCC AATCCCCATCCCTGTCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 31, 4: 279} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!