ID: 1021451051_1021451060

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1021451051 1021451060
Species Human (GRCh38) Human (GRCh38)
Location 7:20784421-20784443 7:20784454-20784476
Sequence CCGAGCCGCCGCCGCCGCCGCCG TCTTCACGTGCTTGCTGAGGTGG
Strand - +
Off-target summary {0: 23, 1: 168, 2: 330, 3: 758, 4: 1941} {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!