ID: 1022112244_1022112252

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1022112244 1022112252
Species Human (GRCh38) Human (GRCh38)
Location 7:27239038-27239060 7:27239064-27239086
Sequence CCTTATTCCCCAGGGGTGCACCC AGTGGCACTAGGTTCCCAAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!