ID: 1022312728_1022312733

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1022312728 1022312733
Species Human (GRCh38) Human (GRCh38)
Location 7:29212466-29212488 7:29212498-29212520
Sequence CCTCCATGGATCTGCTTATTCAG GATTCTTCCACCAGTCCCAAAGG
Strand - +
Off-target summary {0: 4, 1: 2, 2: 2, 3: 12, 4: 169} {0: 5, 1: 0, 2: 4, 3: 18, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!