ID: 1022542094_1022542103

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1022542094 1022542103
Species Human (GRCh38) Human (GRCh38)
Location 7:31146833-31146855 7:31146877-31146899
Sequence CCCACAATCACTGTGCTCTCCCT CGCACCACACAGCCACTGATGGG
Strand - +
Off-target summary {0: 23, 1: 59, 2: 130, 3: 192, 4: 423} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!