|
Left Crispr |
Right Crispr |
| Crispr ID |
1022676128 |
1022676131 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:32500871-32500893
|
7:32500889-32500911
|
| Sequence |
CCCCATTGCTTATTTTGTCAGGT |
CAGGTTTGTCAAAGAGCAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 67, 2: 127, 3: 143, 4: 285} |
{0: 48, 1: 5885, 2: 3882, 3: 2464, 4: 2034} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|