ID: 1022682834_1022682847

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1022682834 1022682847
Species Human (GRCh38) Human (GRCh38)
Location 7:32566283-32566305 7:32566331-32566353
Sequence CCTCCCACCACAGCCTCCCAAGT CACGCCCAGCTAATTTTTTGTGG
Strand - +
Off-target summary {0: 94, 1: 8741, 2: 21150, 3: 66655, 4: 130103} {0: 8, 1: 66, 2: 227, 3: 440, 4: 599}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!