ID: 1022682840_1022682847

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1022682840 1022682847
Species Human (GRCh38) Human (GRCh38)
Location 7:32566296-32566318 7:32566331-32566353
Sequence CCTCCCAAGTAGCTGGGACTACA CACGCCCAGCTAATTTTTTGTGG
Strand - +
Off-target summary {0: 41507, 1: 154089, 2: 219927, 3: 224998, 4: 456875} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!