ID: 1022898413_1022898421

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1022898413 1022898421
Species Human (GRCh38) Human (GRCh38)
Location 7:34776805-34776827 7:34776840-34776862
Sequence CCCTTCAAGGCAGTAGTTTCCCT CATGTCTAGAAATGCCATCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 11, 2: 69, 3: 246, 4: 641}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!