ID: 1022920442_1022920445

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1022920442 1022920445
Species Human (GRCh38) Human (GRCh38)
Location 7:35008039-35008061 7:35008059-35008081
Sequence CCTGCTTTCCACATACTAGATTT TTTTGGCCTTTGTCTCTCCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 190} {0: 1, 1: 1, 2: 2, 3: 31, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!