|
Left Crispr |
Right Crispr |
Crispr ID |
1023227731 |
1023227735 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:37988945-37988967
|
7:37988969-37988991
|
Sequence |
CCTTCCTCCACCTTCTTGTTCTA |
TAGATGATGCCTGACCACATCGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 40, 2: 125, 3: 349, 4: 1075} |
{0: 2, 1: 4, 2: 30, 3: 109, 4: 406} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|