ID: 1023227731_1023227736

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1023227731 1023227736
Species Human (GRCh38) Human (GRCh38)
Location 7:37988945-37988967 7:37988974-37988996
Sequence CCTTCCTCCACCTTCTTGTTCTA GATGCCTGACCACATCGGTGTGG
Strand - +
Off-target summary {0: 5, 1: 40, 2: 125, 3: 349, 4: 1075} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!