ID: 1023282921_1023282935

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1023282921 1023282935
Species Human (GRCh38) Human (GRCh38)
Location 7:38590332-38590354 7:38590385-38590407
Sequence CCCACACCCTGCCAGATCTGGAG CGGCATTCAGCAGTGGTGGATGG
Strand - +
Off-target summary No data {0: 5, 1: 11, 2: 76, 3: 154, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!