|
Left Crispr |
Right Crispr |
| Crispr ID |
1023824844 |
1023824851 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:44002119-44002141
|
7:44002157-44002179
|
| Sequence |
CCAACATGGTGAAACCCTGTCTC |
AATGAGCTGGGCGTTCTGGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 31762, 1: 84237, 2: 130975, 3: 115475, 4: 69762} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|