ID: 1024023601_1024023608

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1024023601 1024023608
Species Human (GRCh38) Human (GRCh38)
Location 7:45392141-45392163 7:45392192-45392214
Sequence CCGGAGGTCCAGGAGATAACCTG GAAACTGCCAGAGTCACAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 144} {0: 1, 1: 1, 2: 3, 3: 34, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!