|
Left Crispr |
Right Crispr |
| Crispr ID |
1024298930 |
1024298936 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:47870801-47870823
|
7:47870845-47870867
|
| Sequence |
CCAGCCTGGGCAACATGATGAAA |
TGCCTATAATCCCAGCTACTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 825, 1: 17240, 2: 126298, 3: 210528, 4: 267266} |
{0: 4701, 1: 62037, 2: 110139, 3: 168034, 4: 247405} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|