|
Left Crispr |
Right Crispr |
Crispr ID |
1024298935 |
1024298936 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:47870828-47870850
|
7:47870845-47870867
|
Sequence |
CCAGGCATGGTGGCATGTGCCTA |
TGCCTATAATCCCAGCTACTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 248, 1: 3128, 2: 13570, 3: 41847, 4: 90675} |
{0: 4701, 1: 62037, 2: 110139, 3: 168034, 4: 247405} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|