ID: 1024336708_1024336713

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1024336708 1024336713
Species Human (GRCh38) Human (GRCh38)
Location 7:48215297-48215319 7:48215350-48215372
Sequence CCAAACAGTGGAGCAGTCAGAAT TCTTATATGGGCATGGTTTGTGG
Strand - +
Off-target summary No data {0: 25, 1: 61, 2: 188, 3: 315, 4: 547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!