ID: 1024801688_1024801699

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1024801688 1024801699
Species Human (GRCh38) Human (GRCh38)
Location 7:53087158-53087180 7:53087192-53087214
Sequence CCTGGGGGCTCCTGGTGTCCCAT GAAGAATACTTTGGAGGGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!