ID: 1024915134_1024915146

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1024915134 1024915146
Species Human (GRCh38) Human (GRCh38)
Location 7:54490613-54490635 7:54490655-54490677
Sequence CCAAGGTCCCCACCTCCTAATAC ATTTCAGCACATTAATTTAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 18, 3: 227, 4: 1308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!