ID: 1025199590_1025199595

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1025199590 1025199595
Species Human (GRCh38) Human (GRCh38)
Location 7:56953893-56953915 7:56953917-56953939
Sequence CCCAATGTCTGCCACTGACTTTG AATGCATGGAAATTTGGAATTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 28, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!