ID: 1025213054_1025213060

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1025213054 1025213060
Species Human (GRCh38) Human (GRCh38)
Location 7:57032161-57032183 7:57032202-57032224
Sequence CCCCAGGAAACCAGGGAGTGCTG AACCCACACTTTGCATATGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!