ID: 1026067661_1026067676

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1026067661 1026067676
Species Human (GRCh38) Human (GRCh38)
Location 7:67089350-67089372 7:67089401-67089423
Sequence CCATTCCCAAGGCTTAGGTATCC CTGGTAAAGGTCGAAGCGCTGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 2, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!