ID: 1026205267_1026205275

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1026205267 1026205275
Species Human (GRCh38) Human (GRCh38)
Location 7:68251808-68251830 7:68251849-68251871
Sequence CCCTCCATGTTCCTGGATCATTC GGTGAAGGCACTAGCTTTCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!