|
Left Crispr |
Right Crispr |
| Crispr ID |
1026656907 |
1026656911 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:72264623-72264645
|
7:72264656-72264678
|
| Sequence |
CCTGAGTATCCAAGACCACAGGT |
CACACCCAGCTGATTTTTTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 79, 3: 1252, 4: 11249} |
{0: 1, 1: 13, 2: 62, 3: 196, 4: 507} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|