ID: 1027108184_1027108199

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1027108184 1027108199
Species Human (GRCh38) Human (GRCh38)
Location 7:75418630-75418652 7:75418674-75418696
Sequence CCAGAAGGGAAAGGGCCCCAGGG TGAAGCCAGAGATCCGGGGTAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 33, 4: 269} {0: 3, 1: 0, 2: 2, 3: 22, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!