|
Left Crispr |
Right Crispr |
| Crispr ID |
1027111547 |
1027111557 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:75443660-75443682
|
7:75443704-75443726
|
| Sequence |
CCAGACGCAGTGGCTCATGCCTG |
GGAGGCGGGCGGATCACCTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 281, 1: 7518, 2: 42720, 3: 106921, 4: 144572} |
{0: 86, 1: 4985, 2: 33721, 3: 87905, 4: 112318} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|