|
Left Crispr |
Right Crispr |
Crispr ID |
1027111552 |
1027111557 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:75443687-75443709
|
7:75443704-75443726
|
Sequence |
CCCAGCACTTCGAAGGCGGAGGC |
GGAGGCGGGCGGATCACCTGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 1, 2: 67, 3: 1131, 4: 3206} |
{0: 86, 1: 4985, 2: 33721, 3: 87905, 4: 112318} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|