|
Left Crispr |
Right Crispr |
| Crispr ID |
1027256652 |
1027256657 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:76435032-76435054
|
7:76435084-76435106
|
| Sequence |
CCGGGAAGTACTGGTAAGTGGTT |
TGCCCATAATCCCAGCACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 0, 2: 0, 3: 3, 4: 78} |
{0: 486, 1: 12426, 2: 116596, 3: 246369, 4: 242011} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|