ID: 1027316777_1027316784

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1027316777 1027316784
Species Human (GRCh38) Human (GRCh38)
Location 7:76990545-76990567 7:76990565-76990587
Sequence CCCTCCTTTTGCTCTCTGGGTAC TACGTGGGCCTGATGACGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!