ID: 1028160101_1028160125

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1028160101 1028160125
Species Human (GRCh38) Human (GRCh38)
Location 7:87475714-87475736 7:87475761-87475783
Sequence CCTCGCCCCCGCCCCCGCCCCCG AAACGCCTACCGTTGCAGCCAGG
Strand - +
Off-target summary {0: 79, 1: 135, 2: 508, 3: 1876, 4: 8520} {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!