ID: 1028160105_1028160129

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1028160105 1028160129
Species Human (GRCh38) Human (GRCh38)
Location 7:87475722-87475744 7:87475768-87475790
Sequence CCGCCCCCGCCCCCGCCCCCCAC TACCGTTGCAGCCAGGGCGAGGG
Strand - +
Off-target summary {0: 5, 1: 40, 2: 396, 3: 2544, 4: 18083} {0: 1, 1: 0, 2: 0, 3: 0, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!