ID: 1028160106_1028160129

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1028160106 1028160129
Species Human (GRCh38) Human (GRCh38)
Location 7:87475725-87475747 7:87475768-87475790
Sequence CCCCCGCCCCCGCCCCCCACGCG TACCGTTGCAGCCAGGGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 41, 3: 377, 4: 2792} {0: 1, 1: 0, 2: 0, 3: 0, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!