ID: 1028160107_1028160128

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1028160107 1028160128
Species Human (GRCh38) Human (GRCh38)
Location 7:87475726-87475748 7:87475767-87475789
Sequence CCCCGCCCCCGCCCCCCACGCGC CTACCGTTGCAGCCAGGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 38, 3: 338, 4: 2444} {0: 1, 1: 0, 2: 1, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!