ID: 1028160119_1028160126

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1028160119 1028160126
Species Human (GRCh38) Human (GRCh38)
Location 7:87475739-87475761 7:87475762-87475784
Sequence CCCCACGCGCGTCCGGCCCGGGA AACGCCTACCGTTGCAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 72} {0: 1, 1: 0, 2: 0, 3: 0, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!