ID: 1028160122_1028160131

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1028160122 1028160131
Species Human (GRCh38) Human (GRCh38)
Location 7:87475751-87475773 7:87475774-87475796
Sequence CCGGCCCGGGAAACGCCTACCGT TGCAGCCAGGGCGAGGGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54} {0: 1, 1: 0, 2: 4, 3: 52, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!