ID: 1028192268_1028192269

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1028192268 1028192269
Species Human (GRCh38) Human (GRCh38)
Location 7:87867043-87867065 7:87867064-87867086
Sequence CCACTGGGTGGTGTGCGGCTGGT GTTTTCCCAACATATGCCTTAGG
Strand - +
Off-target summary {0: 1, 1: 20, 2: 21, 3: 23, 4: 135} {0: 1, 1: 0, 2: 1, 3: 9, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!