ID: 1028417590_1028417602

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1028417590 1028417602
Species Human (GRCh38) Human (GRCh38)
Location 7:90596395-90596417 7:90596422-90596444
Sequence CCCGGCACCACGTAAACCGCCCC CGCCCAGCTGCGGCCCAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61} {0: 1, 1: 0, 2: 3, 3: 46, 4: 504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!