ID: 1028587723_1028587731

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1028587723 1028587731
Species Human (GRCh38) Human (GRCh38)
Location 7:92468275-92468297 7:92468311-92468333
Sequence CCAGAGGGATGGGAGTCAGCGGC CGGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary {0: 4, 1: 34, 2: 91, 3: 116, 4: 216} {0: 62, 1: 126, 2: 64, 3: 58, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!