|
Left Crispr |
Right Crispr |
| Crispr ID |
1028589083 |
1028589093 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:92477752-92477774
|
7:92477798-92477820
|
| Sequence |
CCTGCAGGATCCAGAGGGATGGG |
TGGCAAACAGCAGTGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 44, 3: 126, 4: 391} |
{0: 41, 1: 78, 2: 97, 3: 99, 4: 296} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|