|
Left Crispr |
Right Crispr |
| Crispr ID |
1028690196 |
1028690199 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:93642193-93642215
|
7:93642207-93642229
|
| Sequence |
CCATGTCCCATCTGTGTGGGACC |
TGTGGGACCCCACTGAAAATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 82, 1: 298, 2: 258, 3: 133, 4: 248} |
{0: 173, 1: 150, 2: 196, 3: 148, 4: 190} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|