ID: 1028935009_1028935014

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1028935009 1028935014
Species Human (GRCh38) Human (GRCh38)
Location 7:96455033-96455055 7:96455072-96455094
Sequence CCCTGCCATCTTCTGCAGATAAT GACAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 162, 1: 189, 2: 129, 3: 114, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!