ID: 1029045267_1029045274

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1029045267 1029045274
Species Human (GRCh38) Human (GRCh38)
Location 7:97621312-97621334 7:97621363-97621385
Sequence CCCAGGATTTAGATACAAATGAT AGGGGTAGAAGAAACAGGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 52, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!