ID: 1029078175_1029078184

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1029078175 1029078184
Species Human (GRCh38) Human (GRCh38)
Location 7:97952166-97952188 7:97952207-97952229
Sequence CCCCCAGAGTTCAATAGGCCCTT ATGCACTTGAAGGGTTAAAAAGG
Strand - +
Off-target summary No data {0: 13, 1: 14, 2: 30, 3: 34, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!