ID: 1029238826_1029238846

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1029238826 1029238846
Species Human (GRCh38) Human (GRCh38)
Location 7:99144133-99144155 7:99144183-99144205
Sequence CCGTGCCGGCCCGGCCCTGCGCG CCGCCACGTACGCTGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 396} {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!